Chapter 21: Problem 11
Explain why decapping and deadenylation are common mechanisms involved in RNA decay.
/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none}
Learning Materials
Features
Discover
Chapter 21: Problem 11
Explain why decapping and deadenylation are common mechanisms involved in RNA decay.
All the tools & learning materials you need for study success - in one app.
Get started for free
The DNA sequence of a gene follows. If this is the sense strand, write the sequence of the mRNA transcript formed. CGCGGATCCTTGAATTCTAAATAAACCATTT ACCACCATGACC
Why is the phosphorylation state of the RNA polymerase II CTD an important component of transcription? Describe the changes that the CTD undergoes from initiation to termination.
Why does tRNA contain more types of base modifications than rRNA?
Why is \(\mathrm{Mg}^{2+}\) essential for the activity of RNA polymerase?
TATA-less promoters do not contain a recognizable TATA box but are still associated with TBP. What features are often found in these promoters?
What do you think about this solution?
We value your feedback to improve our textbook solutions.